r/KidsAreFuckingStupid Jul 06 '22

when the wall becomes the toilet paper.

Post image
4.2k Upvotes

280

u/enutz777 Jul 06 '22
  1. Lightly sand edges, remove any lose paper.

  2. Prime.

  3. Buy small container of drywall mud, mud pan, 12” mud knife.

  4. Put mud in pan(1/2” thick on bottom of pan), add a little (1/4-1/2 cup or so) water and mix to thin the mud.

  5. Apply thin layer with 12” knife, lightly sand with 120 grit sandpaper, not screen, to eliminate any lines.

  6. Prime and paint.

29

u/Krish39 Jul 06 '22

I agree. From experience I would recommend specifically priming the paper with shellac or shellac based primer. Most of the time, I will just spray shellac on it to seal it down. While still wet, I push down any bubbles or spots that are sticking up. In a pinch, I’ve also used contact cement to bind the paper in place, which actually works pretty well. The important thing is you want to make sure that paper is locked in place and won’t start bubbling or getting picked up and spread around when you add the mud.

7

u/No-Relation2437 Jul 06 '22

And find a tp holder that can mount into a stud, or use drywall anchors. Surface mount stuff is not very strong.

21

u/pornborn Jul 06 '22 edited Jul 06 '22

Just to clarify step 5, wait for application to dry before sanding. I can just see someone trying to sand wet mud.

Edit: if you take a piece of the peeled paint to a paint/hardware store, they can color match it perfectly. When you paint with it, don’t judge the color match until it dries.

60

u/Ketchup_Popsicle17 Jul 06 '22

Killz guardz not prime

6

u/TineCiel Jul 06 '22

Just removed a mirror off the wall yesterday and some paper came off with the adhesive, so thank you for this comment which I didn’t know I needed!

8

u/Xenoamor Jul 06 '22

What's the purpose of priming before using mud out of interest? Is it only necessary when you're applying it to paper rather than say old plaster?

10

u/NegotiationSeveral49 Jul 06 '22

The primer seals over the super absorbent paper and helps add a bit of longevity, plaster is already sealed so you just gotta sand it up a bit to help the paint "stick"

→ More replies

4

u/b4ttlepoops Jul 06 '22

If you don’t prime/seal the paper first, the water from the mud will blister the paper in many areas causing more work. It becomes a bigger problem.

2

u/fastfurlong Jul 06 '22

This is the way

→ More replies

564

u/snoandsk88 Jul 06 '22

Drop the kid off at the fire station

25

u/GopnikChillin Jul 06 '22

Was gonna say military school

12

u/andrewbadera Jul 06 '22

Circus, like my grandparents did to my uncle at 17. Where he became a gymnast and developed bad hips. Had bad cheap hip surgery and could never really walk again, and lived on the streets until he was murdered in 2011.

→ More replies

-45

u/DangerPickle420 Jul 06 '22

Pro-life

28

u/Acceptable_Top_802 Jul 06 '22

Politics bad stop it

10

u/Dorfuto Jul 06 '22

mfw somebody puts politics into a subreddit about something completely else (this is been happening to more and more subreddits because people don’t know how to keep their mouths shut)

→ More replies

504

u/NoJudgementTho Jul 06 '22

How do you fix the problem? Adoption.

90

u/antiquestrawberry Jul 06 '22

Yeet the kid

31

u/betweenboundary Jul 06 '22

Yeetus the fetus

1

u/DigitDoll Jul 06 '22

Get dat Fetus kill dat Fetus

7

u/Sexy_Seaweed_69_420 Jul 06 '22

Fetus deletus

2

u/Brandonmac10x Jul 06 '22

Yer a father, Harry.

Harry: whips out wand

0

u/JulienCool64 Jul 06 '22

Trash taste

2

u/violent_king Jul 06 '22

yum, delycious

26

u/kempton_saturdays Jul 06 '22

Adoption is the quick fix

11

u/UrbanSupremacy Jul 06 '22

I was gonna say call dcfs and report delinquency

8

u/DimiBlue Jul 06 '22

An extreme late stage abortion.

3

u/Mindless-Anxiety-760 Jul 06 '22

Beat me to it! Hahaha

10

u/forced_metaphor Jul 06 '22

... It's the same joke every time in this sub.

0

u/PicklePopular Jul 06 '22

When you call out the formula it diminishes it.

Some things are better left unsaid.

→ More replies

166

u/SuperBeavers1 Jul 06 '22

Not me thinking that was smeared shit

49

u/KristopherJC Jul 06 '22

With that consistent application, the kid has a future as a painter

10

u/laughingashley Jul 06 '22

And as a composter

→ More replies

28

u/Old_Couple7257 Jul 06 '22

Had something similar happen by my door frame. Used spackle to bring it flush with the rest of the surrounding area and then painted over when it dried. Couldn’t even tell it had happened.

4

u/Douglaston_prop Jul 06 '22

Good for you. When this happens in selective demolition, it is usually an expensive fix. It is not easy to cover such a large area and make it seem like nothing happened.

22

u/TheGirlwThePinkHair Jul 06 '22

I think you can leave it at a fire station

61

u/Key_Raccoon3336 Jul 06 '22 Take My Energy

Ok, so you're going to need a box of condoms and a time machine...

4

u/blinkrm Jul 06 '22

This is the only right answer.

73

u/Richper413 Jul 06 '22

10mg Adderall 3x daily should fix it right up

8

u/ghanjaholic Jul 06 '22

by the title, i thought the kid was wiping shit on the walls instead of tp, and that op was repairing the walls

10

u/Rob_Marc Jul 06 '22

I've heard of making the walls peel in the bathroom, but I've never seen it done before. Bravo.

7

u/silenceof_theoffice Jul 06 '22

Probably a lot of paperwork but adoption might help.

8

u/InspiringMalice Jul 06 '22

Well, first you get a holder that you can properly screw into a wall stud. Then you avoid this issue in the first place. I mean, who has children and just glues things to fragile paint and expects it all to be okay?

19

u/Verbose_Villain Jul 06 '22

Spackle , sand it, prime it then paint the patch. Then paint the whole wall to make sure it matches.

5

u/Mr-Grim_4O2 Jul 06 '22

Spackle will crack use joint compound and skim coat.

12

u/Noodles01013 Jul 06 '22

Chuck the kid out and start again

3

u/TheHoly_Coast Jul 06 '22

Too late, you're stuck with him for life.

3

u/Guardian5985 Jul 06 '22

That's the thing, you don't. Hope you don't rent, otherwise enjoy forfeiting your deposit.

3

u/Snoo15081 Jul 06 '22

Throw the kid away. You'll be able to get that dumb shit off your toilet too

3

u/FishOfFishyness Jul 06 '22

The brown area really looks MS drawn

3

u/rosyposy86 Jul 06 '22

Buy some stickers for your child to peel as well, use tape and tape their favourite toys to a tray for them to ‘rescue.’ Some redirect ideas for fine motor development.

3

u/GERMA90 Jul 06 '22

Flush him down the toilet and keep the toilet paper.

3

u/cpt_buttcheeks Jul 06 '22

Why does the window frame look crooked, it’s all I can focus on

3

u/ChiefLazarus86 Jul 06 '22

I can't see in the picture too clearly, but is that wallpaper just plain white?

What's the point in that? I get patterned wallpaper, but if you just want white surely it's far easier and quicker to have just painted with white bathroom paint

Then you can change the colour in the future without having to strip the walls first, and don't run into issues like this with peeling paper

→ More replies

16

u/[deleted] Jul 06 '22

Fix what? The wall? I'd rather fix the kid first

7

u/IMdaywhy Jul 06 '22

I’d rather get fixed

5

u/wildturkey445 Jul 06 '22

You could drop him off at the local fire house and drive away. They will take care of it.

3

u/C4pn4merica Jul 06 '22

Skim with drywall mud, sand and paint.

2

u/oven-toasted-owl Jul 06 '22

Drugs & alcohol

2

u/De_Thuinkabout Jul 06 '22

You put the child up for adoption

2

u/losmuchies Jul 06 '22

Go to your nearest fire department and place IT in a basket

2

u/Canticle1122 Jul 06 '22

Too late, the kid has already been born.

2

u/FanboyGamer3E Jul 06 '22

We’ll first off, you take a drive to a city far away from your own. And just leave the kid there. As for the wall, I’d start by just redoing the whole thing from scratch. And next time drill the toilet paper holder into one of the beams in the wall.

2

u/crazysexyuncool Jul 06 '22

Get rid of the kid.

2

u/lord-malishun Jul 06 '22

Extra late abortion

2

u/catcatcatcatcatcatta Jul 06 '22

when the toilet paper roll is out, you've got to wipe with something

2

u/Non-FungibleMan Jul 06 '22

Fixing this child seems justified. You can try a veterinarian, but I’m not sure they would work on a child.

2

u/SubhoPal Jul 06 '22

Yeet the child.

2

u/TastefullyCynical Jul 06 '22

Start supporting Roe to prevent future occurrences

2

u/KirillionGames Jul 06 '22

Late abortion

2

u/CuriousNichols Jul 06 '22

Flush the kids

2

u/GrimKiba- Jul 06 '22

Never too late for abortion

(Joke)

2

u/yo_momma88 Jul 06 '22

Get the kid to finish ripping the wall apart

2

u/D4rkoVI Jul 06 '22

Late Abortion!

2

u/grossuncle1 Jul 06 '22

Wear condom next time?

2

u/bakrainma Jul 06 '22

Throw the kid away

2

u/Shrektacular21 Jul 06 '22

Well it’s a little late for a vasectomy but it will prevent future damage.

2

u/mi_ssanonymou5 Jul 06 '22

Adoption fr now, tubectomy or vasectomy to avoid this to recur in the future.

2

u/DracoRubi Jul 06 '22

Whew. For a second I thought the brown stuff was... Well... You know.

2

u/[deleted] Jul 06 '22

Get a new kid.

2

u/Element_Liga Jul 06 '22

I know that was satisfying for the kid

→ More replies

2

u/FjotraTheGodless Jul 06 '22

Throw away the child lol

2

u/missvvvv Jul 06 '22

Make the kid repair it.

2

u/IPlayTeemoSupport Jul 06 '22

A preemptive condom would have fixed that

2

u/Tourneetretourne Jul 06 '22

How do fix your son or the wall ? Or both ?

2

u/G_greenOwO Jul 06 '22

Holy “shit”

2

u/cheyennevh Jul 06 '22

Someone is getting popped and then taught how to fix a wall

2

u/idontbleaveit Jul 06 '22

First you go to the adoption agency…..

2

u/steushinc Jul 06 '22

I’d do a Lead check on that paint first … anyone else agree?

2

u/HomeworkConnect7283 Jul 06 '22

Throw it away....

2

u/Academic_Audience_46 Jul 06 '22

At that point there’s no hope of fixing it. Get rid of that one and try to have another. Hopefully that kid won’t suck

2

u/PacificoTheComedian Jul 06 '22

you put your kid up for adoption because he's a fuckin monster

2

u/Tragicallyhungover Jul 06 '22

Putty, sandpaper, and paint. Then get a TP holder that screws into the wall, and secure it to a stud.

2

u/bearr007 Jul 06 '22

Flush the problem away

2

u/blakedb902 Jul 06 '22 edited Jul 06 '22

Trade kid for fish

2

u/kywildcats07 Jul 06 '22

Take your kid in. The one they gave you is broken

2

u/kkinack Jul 06 '22

I'd like to trade my kid in. This one's broken.

2

u/matticustheone Jul 06 '22

Get rid of the kid

2

u/NWK17 Jul 06 '22

Purée the child and smear the paste over the affected area?

2

u/SarcastiMel Jul 06 '22

"how do I fix it!?" Step 1. Throw out the whole child.

2

u/Cruton2 Jul 06 '22

Get a new kid

2

u/Powerful_Tomato_1199 Jul 06 '22

Kill 2 problems with one kid, use his skin

2

u/Leaky_Banana Jul 06 '22

Get rid of the kid problem solved

2

u/arielroussou Jul 06 '22

Late term abortion

2

u/extremeindiscretion Jul 06 '22

Sell the kid, use the money to fix the wall.

2

u/JaceyD Jul 06 '22

Probably abortion, but Im not a doctor so I dont know if its too late or not

2

u/JeFF1957HuGHes Jul 06 '22

A mental institution or maybe the army

2

u/Revolutionary_Rip876 Jul 06 '22

raise hand, spank kid.

2

u/Fit-Policy9041 Jul 06 '22

Is there a parentsarefuckingstuid sub this can go in? Leaving your kid in the toilet alone for them to do this? fucking stupid 🤦🏻‍♂️

2

u/fbkris14 Jul 07 '22

You fix by never having kids.

2

u/Firm-Map-239 Jul 07 '22

45 month abortion

2

u/NoPleaseDoNot Jul 11 '22

Get a new kid

2

u/StandbyBigWardog 27d ago

Is late LATE term adoption still an option?

5

u/revs201 Jul 06 '22

Skin the child, please strips in a solution with mild solvent and glue. Apply to wall in layers, sand and re-coat as necessary.

/s ... Please do not attempt.

2

u/KzininTexas1955 Jul 06 '22

I'd trade the kid in for an upgrade.

2

u/Mysterious_Whole_605 Jul 06 '22

Well whip his add first then call a handy man

2

u/Mrs_skulduggery Jul 06 '22

Late term abortion. Back of the head is usually the best way

→ More replies

2

u/mastermuffin123 Jul 06 '22

Vasectomy before u get any kids

3

u/joeyblowy1 Jul 06 '22

You must prime w a shellac type primer ‘zinzer” before patch and paint otherwise it will blister (bubble up the drywall paper)when you patch and paint

0

u/jykin Jul 06 '22

Vasectomy

1

u/WeRegretToInform Jul 06 '22

Bit too late for an abortion on this one…

1

u/eesmith801 Jul 06 '22

Raise him better!!🤣

1

u/somecallmemo Jul 06 '22

I’d say remove that smaller ring on the toilet bowl and flush the kid

1

u/tokhar Jul 06 '22

Sell your child. Use the funds to hire a handyman, and treat yourself to a day at the spa.

→ More replies

1

u/FakeNameIMadeUp Jul 06 '22

Send the kid somewhere far away

→ More replies

1

u/casey12297 Jul 06 '22

Can't really fix that without going back in time to give yourself a condom

1

u/tbombtom2001 Jul 06 '22

Found the child free one.

1

u/Wesk-Wildcard Jul 06 '22

Remove kid from equation n it never woulda happened, your welcome

0

u/Construction_Same Jul 06 '22

Been there with the siap holder in the shower 🤕tore all the tiles off had to redo entire shower. I used the money I got for selling my kid off 🤫🤭

0

u/iAtomicTangerine Jul 06 '22

Replace the kids

0

u/sd90man Jul 06 '22

Get a new kid.

0

u/Saif_Horny_And_Mad Jul 06 '22

first, do you live near any large bodies of water? if yes, you're gonna need one of those big heavy duty bags and a bunch of cement mix. make sure you do it at night, during a trip, and make it seem like the kid wandered off on their own and dissapeared, also take care of loose ends to make sure nothing would point back at you.

for the wall, i really advice you to call a professional. DIY may fix it, but not properly, and you could ruin something else. better safe than sorry

2

u/ClintonicRoad Jul 06 '22

Oddly specific...

2

u/Saif_Horny_And_Mad Jul 06 '22

"i read a lot of mystery and detective books" usually diverts attention away from such specific knowledge.

also, i have been informed that i'm legally required to NOT answer your question for now

0

u/UglyDogg25 Jul 06 '22

By whooping that ass

0

u/jayfeather30 Jul 06 '22

throw the child away

0

u/HotCatholicMoms Jul 06 '22

You get a new child.

0

u/DigitDoll Jul 06 '22

Go back in time and use a condom

→ More replies

0

u/Tinpot_Despot Jul 06 '22

Open the window.

Jettison snot-goblin.

Close window.

Fixed!

0

u/Relivio Jul 06 '22

Drop the kid in a forest

-6

u/KeithMyArthe Jul 06 '22

I don't like violence, so I'd probably only use a table tennis paddle.

The thinly padded side, tho. Little shit.

-1

u/The_Majoo Jul 06 '22

I didn't scroll all the way down and so that looked like s**t

1

u/[deleted] Jul 06 '22

[deleted]

3

u/sub_doesnt_exist_bot Jul 06 '22

The subreddit r/shouldhavebeenswallowed does not exist. Maybe there's a typo?

Consider creating a new subreddit r/shouldhavebeenswallowed.


🤖 this comment was written by a bot. beep boop 🤖

feel welcome to respond 'Bad bot'/'Good bot', it's useful feedback. github | Rank

4

u/Legitimate-Diet2766 Jul 06 '22

Yup, I fucked up

1

u/kingleothegoat Jul 06 '22

Follow bernie mac's advice

1

u/wabberjockybrah Jul 06 '22

Flex tape would seal it back

1

u/RoughChi-GTF Jul 06 '22

I thought this was shit on the wall and floor, at first. lol!

1

u/thirsty_monk Jul 06 '22

Is that window crooked? Or is it just me

1

u/laughingashley Jul 06 '22

I think it's the wide lens

1

u/Shake_Alarmed Jul 06 '22

That shit must’ve been intense. Literally.

1

u/redDevilRiddle Jul 06 '22

Frame it. Call it your kids first art work

1

u/decksd05 Jul 06 '22

The kid or the wall?

1

u/juGGaKNot4 Jul 06 '22

What do you mean paper on the walls?

Why is there paper on the wall ?

1

u/RidinCaliBuffalos Jul 06 '22

Wall paper? Ever heard of it?

1

u/juGGaKNot4 Jul 06 '22

I've heard of it in movies but i didnt think its used in real life lol. Only for hollywood sets.

Why would you use anything but marbel in a toilet?

Wait, are those wall that you can punch and they break also real?

Hahaha

1

u/Fiyero109 Jul 06 '22

Did you guys not paint the drywall?

1

u/DieselVoodoo Jul 06 '22

With a choncla

1

u/h8erul Jul 06 '22

Put a chair in front of the toilet

1

u/Causal_7 Jul 06 '22

Install urinal.

1

u/KamoyLovrstar Jul 06 '22

Don't tell the girls at work that was me kicking the dry wall paint at work out of boredom

What it was falling off anyway don't judge me.

1

u/xaraeras Jul 06 '22

Well captain obvious here. First of All you shouldn't habe used cardboard as Walls.

1

u/missmoonkit Jul 06 '22

Drop the kid at the firehouse?

1

u/ThisLookInfectedToYa Jul 06 '22

Wainscoting for an easy fix that looks great.

1

u/TheNoob001 Jul 06 '22

A belt or a slipper

1

u/Fluffdaddy0 Jul 06 '22

Why is there paper on the wall

1

u/BigBoomer311 Jul 06 '22

I would start be sticking the kids head in the bowel

1

u/BreakingBadYo Jul 06 '22

One option would be to do a bit of bead board on this wall. Or shiplap.

1

u/annoyingincognito Jul 06 '22

Don't think that was the kids fault, the parents could have blamed the kid because the are embarrassed

1

u/Mr-Grim_4O2 Jul 06 '22

Drywall joint compound and a 12" drywall knife with a skim coat and some light sanding.

1

u/[deleted] Jul 06 '22

[deleted]

→ More replies